LirikChord Adele Ukulele Gitar Pemula. Videos; Category; Entertainment; Home. pop indonesia. chord gita mahen - pura - pura lupa Devi. PURA PURA LUPA PRODUKSI : INDO SEMAR SAKTI CHORD GITAR PURA PURA LUPA Intro : A# Gm D# D G D Em D C D G G Em Belajargitar dengan lagu terbukti dapat melatih keterampilan serta lebih cepat meningkatkan skil pemainnya. Am D G Biar aku yang pura-pura lupa. Berikut Chord Gitar dan Lirik Lagu Pura-Pura Lupa - Mahen bahagiakan dia aku tak apa. A B C D E F G, Am Bm Cm. Berikut chord ukulele dan lirik lagu Pura Pura Lupa yang dipopulerkan Mahen. berada di pelukan mu - Em Am mengajarkanku ap a artinya kenyaman an kesempurn aan cin ta.. Reff II: bera da di pelukan mu - Fm A#m mengajarkanku G#m - C# F# apa artinya kenyamanan kesempurn aan cin ta.. berd ua bersamam u - Fm A#m mengajarkanku G#m - C# F# apa artinya kenyamanan kesempurnaa n cin ta.. Outro : C# A#m B G# C# .. LirikSementara Chord Gitar Pemula Piano Ukulele Mudah. Videos; Category; Entertainment; Home. pop indonesia. chord gita mahen - pura - pura lupa Haryo. INDO SEMAR SAKTI CHORD GITAR PURA PURA LUPA Intro : A# Gm D# D G D Em D C D G G Em . album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratioDBmGBGmEFDmCmDCACGFFmAm arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNDNNNBmNNNGNNNBmNBNNNNNGmNNNENNNGmNFNNNNNNGmNNENNNBNDmNENNNBNGmNCmNNNBNNNNNFNGmNNNNENNBNNNENNNGmNNNCmNNNDNNNGmNNNGNNNBNNNCNNNCmNNNBNFNBNNNENFNBNNNFNNNGmNNNBNNNENNNDmNGmNANNNFNNNBNNNFNNNGmNNNBNNNENNNDmNGmNCmNNNBNFNBNNNNNNNENNNBNNNDNNNCmNNNCNNNBmNNNGNNNFNDNGmNNNGNNNFNBNFNNNCmNNNENFNBNNNENFNBNNNFNNNGmNNNBNNNENNNBNGmNANNNFNNNBNNNFNNNGmNNNFNNNENNNBNGmNCmNNNBNFNBNNNFNGNCNNNFmNNNAmNNNFmNFNNNNNFmNAmNBNNNCNNNNNNNGNNNAmNNNCNNNFNNCNNAmNDmNNNCNGNCNAmNNNCNFNNNAmNGNFNNNFmNAmNDmNNNCNGNNNCNFNNGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCCCCCCCGCAmCCCCFCGCCCFCCCAmCCCFCCCGCCCCCGCCCAmCFCCCGCCCFCCAmCCCCDmCCCGCCCCCCCCCCCGCCCGCCCCCFCGCCCCCCCCFGCCCCCGCCCCCACFGCCCFCCGCCCCFCCGCCCCFCCAmGCCCCCCEmCGCBCCCCCCCCFCCDGCCCCCCCCCCGCCFCEmCCCGCCCCDmFmGCFCGCCCCCCCFCGCCFCCGCCCCCAmCFGCCCCCCCEmCCFCCCGCCCCFCCGCCCCCCCGCCCCCCCGCCCCGFCGCCCCCCCCCCACCGCCCCFmGCCCCACCGCCCCDCCGCCCCACFmCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratioCBmDGEmCmFmFACFDmEBGmGAmFm arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNCNNBmNNDNNNGNNNDNNNNNNNNNBmNNNNNGNNNNNNDNNNGNNNNDNNNNEmNNNNNDNNNNNNNCmNDNNNNNGNNNNFmNNNNNGNNNNFmNNBmNEmNNNNNBmNNNNNNNNNNFNNNANNNNNNNNEmNNNNNNNANNNNDNNNNGNNNDNNNNNNNANNNNBmNNNNANNNNGNNNNNDNNNNCNNNNANNNNNDNNNNNANNNBmNNNNNANNNNGNNNNDNNNNNEmNNNNANNNNDNNNNNNNNNNGNNNNNFmNNNNFNNNNGNNNNNNNNNNDmNNNNNNNNNNANFNNBmNNNNFNNNNNNNANNNENNNEmNNNNNANNNNDNNNNNBmNDNNNNNNNNNANNNBmNNNNANNNNNNGNNNBmNNNNEmNNNNANNNNNDNNNNNANNNNNBmNNNANNNNGNNNNNDNNNNEmNNNNANNNNNDNNNNANNBNENNNNNNBNNCmNNNNNBNNNNNANNNNENNNNNFmNNNNBNNNNENNNNNNNNNNNCmNNNNNNENNNNANNGmNNCmNANNNNNBNNNNENNNNNNNNNNANNNNENNNNNANNNNENNNNFmNNNNBNNNNNENNNNNNANNNNENNNNNNNNNNNNNNNNNCNNNNNNGNNNNNNAmNNNNNNNNNFmNNNNNNCNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNGNCNDBNDNGmNNNNNBNNDmNNNGNNENBNNNGmNNNENNNCmNNNNFNNNNBNNNGmNNNENNNCmNNNNFNNNNDmNNNNNCNNNNENCmNNNFNNDmNNBNDmNNBNNNNNNNDmNNGNNNNBNNDmNGmNNBNNNCmNNNNFNNNNBNNDmNGmNNENNNCmNNNCFNNNNDmNNNNNCNNNNENNCmNNDmNNNNNBNDmNNBNNNNNNNDmNNGNNNBNNNNNGmNNDNNENNBNGNDmNNNNBNNNNNNNNNNCmNGNNNNFNNDmNNNNNNNNBNNNNNNNNGNNNNNNBNNNCmNNNFNNNNNNNNNDNBNNNGmNNNNNNBNNNGmNNNNNBNNDmNNGmNNBNNCmNNNNNFNNENBNDmNNGmNNENNCmNNNCNFNNNNDNNNNNCNNNNENCmNNNDmNNNNBNDNGmNNNNNBNNDNGmNNNNNBNNNNGmNNNDNENNBNGNDmNNNNBNNNNNNNNNNNCmGNNNNFNNNDmNNNNNNNNBNNNNNNNGNNNNNNNCENNCmNNNFNNAmNFNNNNDNBNNGmNNNNNNNBNNGmNNNNNFNNNNNNNNNNNENNNNNNNNNNBNNNNNNNNGmNNCmNNNNNNNNNFNNNNNGNNNNCNNNNNNDmNNNNNNNNNNGNNNCNNAmNNNNNNNDmNNNNNNGNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login

pura pura lupa chord ukulele